Skip to Content
Merck
All Photos(1)

Key Documents

EHU073951

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGACCCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGCATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGACCTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTACCAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTGGTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAACGAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCCCAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCC

Ensembl | human accession no.

ENSG00000130669

NCBI accession no.

NM_005884

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PAK4(10298) , PAK4(10298)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xianghe Lu et al.
Oncology reports, 38(2), 1240-1250 (2017-07-06)
Glioma is an extremely aggressive and lethal type of brain tumour that originates from glial cells. MicroRNA (miRNA) dysregulation has been implicated in the occurrence and progression of many human cancers, including glioma. Thus, some specific miRNAs are potential therapeutic
Amro Aboukameel et al.
Molecular cancer therapeutics, 16(1), 76-87 (2017-01-08)
The p21-activated kinase 4 (PAK4) is a key downstream effector of the Rho family GTPases and is found to be overexpressed in pancreatic ductal adenocarcinoma (PDAC) cells but not in normal human pancreatic ductal epithelia (HPDE). Gene copy number amplification
Shi-Xun Lu et al.
Cancer letters, 402, 71-80 (2017-06-05)
The dysregulation of transcription factors contributes to the unlimited growth of cancer cells. Zic2 has been shown to be crucial to the progression of human cancers. However, its role in hepatocellular carcinoma (HCC) remains unclear. Our data showed that Zic2
Helen King et al.
Scientific reports, 7, 42575-42575 (2017-02-17)
It has been reported that p21-activated kinase 4 (PAK4) is amplified in pancreatic cancer tissue. PAK4 is a member of the PAK family of serine/threonine kinases, which act as effectors for several small GTPases, and has been specifically identified to
Xu Zhang et al.
Cancer medicine, 8(12), 5716-5734 (2019-08-08)
The aim of this study is to investigate the functions and mechanisms of miR-608 in prostate cancer (PCa). CISH and qRT-PCR analysis demonstrated that miR-608 was low expressed in PCa tissues and cells, which was partly attributed to the methylation
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service