Skip to Content
Merck
All Photos(1)

Key Documents

EHU072971

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hirofumi Noguchi et al.
Scientific reports, 8(1), 11082-11082 (2018-07-25)
We previously reported that treatment with a JNK inhibitory peptide (11R-JNKI) prevents islet apoptosis and enhances the islet function in vivo. In the present study, we explored more efficient JNK inhibitors. The inhibition of the JNK activity by five types
Wen-Pin Cheng et al.
Journal of the Formosan Medical Association = Taiwan yi zhi, 116(5), 388-397 (2016-09-21)
TRB3 (tribbles 3), an apoptosis-regulated gene, increases during endoplasmic reticulum stress. Hypoxia can induce inflammatory mediators and apoptosis in cardiomyocytes. However, the expression of TRB3 in cardiomyocyte apoptosis under hypoxia is not thoroughly known. We investigated the regulation mechanism of
Namal Perera et al.
International journal of biological sciences, 14(10), 1378-1388 (2018-08-21)
Antrodia cinnamomea (A. cinnamomea) is a medicinal fungus used in traditional Chinese medicine to treat different kinds of ailments, including liver diseases, abdominal pain, drug intoxication, diarrhea, itchy skin, hypertension, and cancer. Polysaccharides have been identified as one of the
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Mei-Chuan Chen et al.
Scientific reports, 7, 46149-46149 (2017-04-08)
Patients with ovarian cancer are typically diagnosed at an advanced stage, resulting in poor prognosis since there are currently no effective early-detection screening tests for women at average-risk for ovarian cancer. Here, we investigated the effects of MT-6, a derivative

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service