Skip to Content
Merck
All Photos(1)

Documents

EHU118761

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTGTGACACTCTGTTGATGTGCATCGTCACTGTCATGAACCATGGGCTACGCAACGGTGGTGGCGTGGGCGACATTCTCCGCAAGCCCTCCAAAGATGAGTCTCTCTTCCCAGCCCGAGTGGTCTATGACCTCCTGTTCTTCTTCATCGTCATCATCATTGTGCTGAACCTCATCTTTGGGGTAATCATCGACACCTTCGCTGACCTGCGTAGTGAGAAGCAGAAGAAGGAGGAGATTCTTAAGACGACATGCTTCATCTGTGGTCTGGAGAGGGACAAGTTTGATAACAAGACAGTGTCATTTGAGGAACACATCAAGCTGGAGCACAACATGTGGAACTACTTGTACTTCATTGTGCTGGTCCGCGTGAAGAACAAGACCGACTACACGGGCCCTGAGAGCTACGTGGCCCAGATGATCAAGAACAAGAACCTGGACTGGTTCCCCCGGATGCGGGCCATGTCCCTTGTCAGCAATGAGGGCGAGGGGGAGCAGAATGAGATTCGGATTCTCCAGGACAAGCTCAACTCCACCATGA

Ensembl | human accession no.

ENSG00000096433

NCBI accession no.

NM_002224

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITPR3(3710) , ITPR3(3709)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Julius Rönkkö et al.
Annals of clinical and translational neurology, 7(10), 1962-1972 (2020-09-20)
ITPR3, encoding inositol 1,4,5-trisphosphate receptor type 3, was previously reported as a potential candidate disease gene for Charcot-Marie-Tooth neuropathy. Here, we present genetic and functional evidence that ITPR3 is a Charcot-Marie-Tooth disease gene. Whole-exome sequencing of four affected individuals in
Francesca Iommelli et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(13), 3126-3136 (2018-04-06)
Purpose: Our aim was to test whether imaging with 18F-fluorothymidine (18F-FLT) PET/CT was able to detect the combined effects of EGFR and MET inhibitors in oncogene-driven non-small cell lung cancer (NSCLC) and to elucidate the mechanisms underlying the enhanced efficacy
Ming He et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(5), 902-914 (2019-03-29)
Objective- The topographical distribution of atherosclerosis in vasculature underscores the importance of shear stress in regulating endothelium. With a systems approach integrating sequencing data, the current study aims to explore the link between shear stress-regulated master transcription factor and its
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Abdallah Mound et al.
Oncotarget, 8(42), 72324-72341 (2017-10-27)
Breast cancer remains a research priority due to its invasive phenotype. Although the role of ion channels in cancer is now well established, the role of inositol (1,4,5)-trisphosphate (IP
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service