Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU001801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tert

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGGTGAACTTCCCTGTGGAGCCTGGTACCCTGGGTGGTGCAGCTCCATACCAGCTGCCTGCTCACTGCCTGTTTCCCTGGTGTGGCTTGCTGCTGGACACTCAGACTTTGGAGGTGTTCTGTGACTACTCAGGTTATGCCCAGACCTCAATTAAGACGAGCCTCACCTTCCAGAGTGTCTTCAAAGCTGGGAAGACCATGCGGAACAAGCTCCTGTCGGTCTTGCGGTTGAAGTGTCACGGTCTATTTCTAGACTTGCAGGTGAACAGCCTCCAGACAGTCTGCATCAATATATACAAGATCTTCCTGCTTCAGGCCTACAGGTTCCATGCATGTGTGATTCAGCTTCCCTTTGACCAGCGTGTTAGGAAGAACCTCACATTCTTTCTGGGCATCATCTCC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

T Liu et al.
British journal of cancer, 108(11), 2272-2280 (2013-05-18)
Telomerase and telomerase reverse transcriptase (hTERT) confer cancer cells sustained proliferation and survival potentials. Targeting telomerase or hTERT is a novel anti-cancer strategy. However, telomerase/hTERT inhibition alone has minimal clinical efficacy. We explored the relationship between hTERT and cyclooxygenase 2
Ki Chan Kim et al.
Molecular neurobiology, 53(10), 7312-7328 (2015-12-24)
In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in
Xin Tian et al.
Evidence-based complementary and alternative medicine : eCAM, 2015, 546210-546210 (2016-01-20)
Bufalin, a digoxin-like active component of the traditional Chinese medicine Chan Su, exhibits potent antitumor activities in many human cancers. Bufalin induces mitochondria-dependent apoptosis in cancer cells, but the detailed molecular mechanisms are largely unknown. hTERT, the catalytic subunit of
Lei Wang et al.
Journal of biomedical nanotechnology, 11(9), 1653-1661 (2015-10-22)
Current diagnostic techniques do not reliably detect cancer at early stages, and traditional chemotherapy lacks specificity and causes systemic toxicity. To address these issues, multifunctional nanomaterials are becoming more widely studied as a means of cancer detection, therapy, and monitoring.
Zhiping Liu et al.
PloS one, 8(1), e53576-e53576 (2013-01-18)
Our previous work had found that telomerase rejuvenated in the cytoplasm of corneal epithelial cells cultured in embryonic stem cell-conditioned medium, the functional properties of stem-like corneal epithelial cells can be enhanced by co-culturing with embryonic stem cells (ESCs) via

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique