Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU136181

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGCATTCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGTGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAAGCCAAGACGCGGAGCGCCGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACCCCCCAGACCCCACCAAGCCGGACTATGACATCCGGGCCGACGTATGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTACAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAAGTCCTACAGGAAGAGCCCCCGCTTCTGCCCGGACACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAAAGACTGCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Junxia Cao et al.
Theranostics, 9(3), 811-828 (2019-02-28)
Targeting cancer stem cells (CSCs) has been proposed as a new strategy to eradicate malignancies, including hepatocellular carcinoma (HCC). However, the mechanisms by which CSCs sustain their self-renewal and chemoresistance remain elusive. Nanog is a master transcriptional regulator of stemness
Marianna Lucafò et al.
Cancer chemotherapy and pharmacology, 86(3), 361-374 (2020-08-11)
Glucocorticoids (GCs) are commonly used as therapeutic agents for immune-mediated diseases and leukemia. However, considerable inter-individual differences in efficacy have been reported. Several reports indicate that the inhibitor of mTOR rapamycin can reverse GC resistance, but the molecular mechanism involved

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique