Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU098701

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPT

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sheng Yi et al.
Journal of cell science, 132(6) (2019-02-21)
Tau protein (encoded by the gene microtubule-associated protein tau, Mapt) is essential for the assembly and stability of microtubule and the functional maintenance of the nervous system. Tau is highly abundant in neurons and is detectable in astrocytes and oligodendrocytes.
Tomi Rantamäki et al.
PloS one, 8(7), e68722-e68722 (2013-07-12)
Brain-derived neurotrophic factor (BDNF) importantly regulates learning and memory and supports the survival of injured neurons. Reduced BDNF levels have been detected in the brains of Alzheimer's disease (AD) patients but the exact role of BDNF in the pathophysiology of
Varun Balaji et al.
Autophagy, 14(12), 2139-2154 (2018-08-28)
Missorting of MAPT/Tau represents one of the early signs of neurodegeneration in Alzheimer disease. The triggers for this are still a matter of debate. Here we investigated the sorting mechanisms of endogenous MAPT in mature primary neurons using microfluidic chambers

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique