Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU098571

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA

Numéro d'accès Ensembl | humain

ENSG00000135679

Numéro d'accès NCBI

NM_002392

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MDM2(4193) , MDM2(4193)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chengtao Sun et al.
OncoTargets and therapy, 13, 10475-10487 (2020-10-30)
Cell-division cycle 20 (CDC20) is overexpressed in a variety of tumor cells and is negatively regulated by wild-type p53 (wtp53). Our previous study uncovered that CDC20 was upregulated and associated with poor outcome in diffuse large B-cell lymphoma (DLBCL) based
Yong Tang et al.
OncoTargets and therapy, 12, 2247-2258 (2019-04-17)
Mouse double minute 2 (MDM2) contributes to cancer metastasis and epithelial-mesenchymal transition (EMT). This study aimed to investigate small mothers against decapentaplegic (Smad) signaling in MDM2-mediated EMT in lung adenocarcinoma (LAC). Expression patterns of MDM2 in LAC tissues, adjacent tissues
Shaneabbas Raza et al.
Molecular and cellular biochemistry, 410(1-2), 187-195 (2015-09-10)
Estrogen is synthesized from cholesterol and high cholesterol levels are suggested to be associated with increased risk of estrogen receptor(ER)-positive breast cancer. The cholesterol metabolite 27-hydroxycholesterol (27-OHC) was recently identified as a selective estrogen receptor modulator (SERM) and may therefore
Bin Zhang et al.
Oncotarget, 8(42), 71894-71910 (2017-10-27)
Growing evidence indicates that 14-3-3ζ and yes-associated protein (YAP) substantially promote tumorigenesis and tumor development. However, the regulatory mechanism underlying these two proteins remains unknown. Herein, we report a new regulatory role of 14-3-3ζ in the phosphorylation of YAP and
Kiyohiro Ando et al.
Journal of oncology, 2020, 2752417-2752417 (2020-10-06)
Checkpoint kinase 1 (CHK1) plays a key role in genome surveillance and integrity throughout the cell cycle. Selective inhibitors of CHK1 (CHK1i) are undergoing clinical evaluation for various human malignancies, including neuroblastoma. Recently, we reported that CHK1i, PF-477736, induced a
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique