Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU085021

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAGAAATGGTTGGTTGGTGGTTTTTTTTAGTTTGTATGCCAAGTGAGAAGATGGTATATTTGGTACTGTATTTCCCTCTCATTTTGACCTACTCTCATGCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATAGAACCACTATGAAGCTACCTCAAACTTCCAGTCAGGTAGTTGCAATTGAATTAAATTAGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGAGGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shan Shi et al.
Molecular medicine reports, 16(6), 9601-9606 (2017-10-19)
Mycoplasma pneumoniae (M. pneumoniae) infection is closely associated with pneumonia in children. Apoptosis of alveolar epithelial cells is involved in the development of pneumonia in children. The present study aimed to examine how caspase‑3 influences apoptosis rates in M. pneumoniae‑infected alveolar epithelial cells.
Chunxi Wang et al.
Cancers, 12(9) (2020-09-17)
T cell receptor (TCR) knockout is a critical step in producing universal chimeric antigen receptor T cells for cancer immunotherapy. A promising approach to achieving the knockout is to deliver the CRISPR/Cas9 system into cells using electrotransfer technology. However, clinical
Md Ataur Rahman et al.
Molecules and cells, 39(2), 119-128 (2015-12-18)
Angelica polymorpha Maxim root extract (APRE) is a popular herbal medicine used for treating stomachache, abdominal pain, stomach ulcers, and rheumatism; however the effect of APRE on cancer cells has not yet been explored. Here, we examined APRE cytotoxicity seen
Behzad Torabi et al.
Apoptosis : an international journal on programmed cell death, 23(1), 65-78 (2017-12-14)
Sp1 is a ubiquitous transcription factor that regulates many genes involved in apoptosis and senescence. Sp1 also has a role in the DNA damage response; at low levels of DNA damage, Sp1 is phosphorylated by ATM and localizes to double-strand
Atthapan Morchang et al.
PloS one, 12(11), e0188121-e0188121 (2017-11-18)
Hepatic dysfunction is a feature of dengue virus (DENV) infection. Hepatic biopsy specimens obtained from fatal cases of DENV infection show apoptosis, which relates to the pathogenesis of DENV infection. However, how DENV induced liver injury is not fully understood.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique