Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU080681

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAACCTGTCAGCATTGAAGGAACTCTCACCTCCGTGGGCCTGAAATGCTTGGGAGTTGATGGAACCAAATAGAAAAACTCCATGTTCTGCATGTAAGAAACACAATGCCTTGCCCTACTCAGACCTGATAGGATTGCCTGCTTAGATGATAAAATGAGGCAGAATATGTCTGAAGAAAAAAATTGCAAGCCACACTTCTAGAGATTTTGTTCAAGATCATTTCAGGTGAGCAGTTAGAGTAGGTGAATTTGTTTCAAATTGTACTAGTGACAGTTTCTCATCATCTGTAACTGTTGAGATGTATGTGCATGTGACCACAAATGCTTGCTTGGACTTGCCCATCTAGCACTTTGGAAATCAGTATTTAAATGCCAAATAATCTTCCAGGTAGTGCTGCTTCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Leon Caly et al.
Biochemical and biophysical research communications, 483(1), 64-68 (2017-01-08)
Respiratory syncytial virus (RSV) is a major cause of respiratory infections in infants and the elderly, leading to more deaths than influenza each year worldwide. With no RSV antiviral or efficacious vaccine currently available, improved understanding of the host-RSV interaction
Takouhie Mgrditchian et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(44), E9271-E9279 (2017-10-29)
While blocking tumor growth by targeting autophagy is well established, its role on the infiltration of natural killer (NK) cells into tumors remains unknown. Here, we investigate the impact of targeting autophagy gene Beclin1 (BECN1) on the infiltration of NK
Thi Thuy Tien Vo et al.
Journal of Cancer, 11(24), 7253-7263 (2020-11-17)
Recently, ambient air particulate matter (PM) has been shown to increase the risk of oral cancer. The most common malignant tumor in the oral cavity is oral squamous cell carcinoma (OSCC). Recent studies have revealed that surfactin, a cyclic lipopeptide
Kevin Berthenet et al.
Cell reports, 31(10), 107731-107731 (2020-06-11)
Triggering apoptosis remains an efficient strategy to treat cancer. However, apoptosis is no longer a final destination since cancer cells can undergo partial apoptosis without dying. Recent evidence shows that partial mitochondrial permeabilization and non-lethal caspase activation occur under certain
Cuiling Zhong et al.
Nature communications, 11(1), 6330-6330 (2020-12-12)
Endothelial cell (EC) metabolism is thought to be one of the driving forces for angiogenesis. Here we report the identification of the hexosamine D-mannosamine (ManN) as an EC mitogen and survival factor for bovine and human microvascular EC, with an

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique