Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU079681

Sigma-Aldrich

MISSION® esiRNA

targeting human S1PR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Numéro d'accès Ensembl | humain

ENSG00000170989

Numéro d'accès NCBI

NM_001400

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... S1PR1(1901) , S1PR1(1901)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized
Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Zhi Zheng et al.
International immunopharmacology, 66, 224-235 (2018-11-27)
Inflammation-induced lymphangiogenesis is a widely accepted concept. However, most of the inflammatory factors and their related mechanisms have not been clarified. It has been reported that sphingosine-1-phosphate (S1P) is not only closely related to the chronic inflammatory process but also
Ting Fang et al.
Frontiers in pharmacology, 11, 529962-529962 (2020-10-27)
Coix Seed Oil (CSO) possesses a wide range of pharmacological activities. Kanglaite Injection, a commercial product of CSO, has been used clinically as an anticancer drug in China for decades. However, its molecular mechanisms on triple-negative breast cancer (TNBC) remains
Shilun Zuo et al.
Molecular neurobiology, 54(2), 1213-1228 (2016-01-29)
Blood-brain barrier preservation plays an important role in attenuating vasogenic brain edema after subarachnoid hemorrhage (SAH). This study was designed to investigate the protective effect and mechanism of artesunate, a traditional anti-malaria drug, on blood-brain barrier after SAH. Three hundred
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique