Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU072801

Sigma-Aldrich

MISSION® esiRNA

targeting human GIPC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGACCACATCCACCTCATCAGCGTGGGCGACATGATCGAGGCCATTAACGGGCAGAGCCTGCTGGGCTGCCGGCACTACGAGGTGGCCCGGCTGCTCAAGGAGCTGCCCCGAGGCCGTACCTTCACGCTGAAGCTCACGGAGCCTCGCAAGGCCTTCGACATGATCAGCCAGCGTTCAGCGGGTGGCCGCCCTGGCTCTGGCCCACAACTGGGCACTGGCCGAGGGACCCTGCGGCTCCGATCCCGGGGCCCCGCCACGGTGGAGGATCTGCCCTCTGCCTTTGAAGAGAAGGCCATTGAGAAGGTGGATGACCTGCTGGAGAGTTACATGGGTATCAGGGACACGGAGCTGGCGGCCACCATGGTGGAGCTGGGAAAGGACAAAAGGAACCCGGATGAGCTGGCCGAGGCCCTGGACGAACGGCTGGGTGACTTTGCCTTCCCTGAC

Numéro d'accès Ensembl | humain

ENSG00000123159

Numéro d'accès NCBI

NM_005716

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GIPC1(10755) , GIPC1(10755)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
EXR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guilong Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13777-13788 (2016-08-03)
Glioma occurs due to multi-gene abnormalities. Neuropilin-1 (NRP-1), as a transmembrane protein, involves in glioma proliferation, invasion, and migration, as well as tumor angiogenesis. The cytoplasmic protein, GAIP/RGS19-interacting protein (GIPC1), could regulate the clathrin-vesicles trafficking and recycling. Here, we show
Ling Wang et al.
PloS one, 2(11), e1161-e1161 (2007-11-15)
Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), one of the crucial pro-angiogenic factors, functions as a potent inhibitor of endothelial cell (EC) apoptosis. Previous progress has been made towards delineating the VPF/VEGF survival signaling downstream of the activation of VEGFR-2.
Xiuping Huang et al.
Nature communications, 10(1), 3708-3708 (2019-08-20)
Neuropilin-1 (NRP1) is an essential transmembrane receptor with a variety of cellular functions. Here, we identify two human NRP1 splice variants resulting from the skipping of exon 4 and 5, respectively, in colorectal cancer (CRC). Both NRP1 variants exhibit increased
Ayumi Yoshida et al.
Biology open, 4(9), 1063-1076 (2015-07-26)
Neuropilin-1 (NRP1) has been identified as a VEGF-A receptor. DJM-1, a human skin cancer cell line, expresses endogenous VEGF-A and NRP1. In the present study, the RNA interference of VEGF-A or NRP1 suppressed DJM-1 cell proliferation. Furthermore, the overexpression of
Santanu Bhattacharya et al.
PloS one, 9(12), e114409-e114409 (2014-12-04)
GAIP interacting protein C terminus (GIPC) is known to play an important role in a variety of physiological and disease states. In the present study, we have identified a novel role for GIPC as a master regulator of autophagy and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique