Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU063551

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGATGCACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATTTCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAAAATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGTTTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTTTCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAGAGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACTATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomohisa Sakaue et al.
Scientific reports, 7, 42845-42845 (2017-02-22)
Vascular endothelial cell growth factor receptor 2 (VEGFR2) is an essential receptor for the homeostasis of endothelial cells. In this study, we showed that NEDD8-conjugated Cullin3 (CUL3)-based ubiquitin E3 (UbE3) ligase plays a crucial role in VEGFR2 mRNA expression. Human
Tomohisa Sakaue et al.
Cancer science, 108(2), 208-215 (2016-12-18)
Vascular endothelial (VE)-cadherin, a major endothelial adhesion molecule, regulates vascular permeability, and increased vascular permeability has been observed in several cancers. The aim of this study was to elucidate the role of the NEDD8-Cullin E3 ligase, in maintaining barrier permeability.
Ang Luo et al.
Journal of proteome research, 19(1), 260-268 (2019-11-26)
Prolyl hydroxylase domain-containing protein 2 (PHD2/EGLN1) is a key regulatory enzyme that plays a fundamental role in the cellular hypoxic response pathway, mediating proline hydroxylation-dependent protein degradation of selected target proteins. However, the regulation of PHD2 homeostasis at the protein
Alexandros P Drainas et al.
Cell reports, 31(1), 107465-107465 (2020-04-09)
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique