Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU060231

Sigma-Aldrich

MISSION® esiRNA

targeting human FAS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGGCTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTCGCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGGTTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCCTGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGGACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG

Numéro d'accès Ensembl | humain

ENSG00000026103

Numéro d'accès NCBI

NM_000043

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FAS(355) , FAS(355)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Neetu Singh et al.
European journal of pharmacology, 815, 462-469 (2017-10-05)
Endothelial dysfunction plays an important role in structural remodeling occurring in the pulmonary vasculature during pulmonary hypertension (PH). Endothelial injury causes apoptosis and activation of endothelial cells. However, some endothelial cells show apoptosis-resistance and later proliferate extensively leading to vascular
Chen-Ting Lee et al.
Radiation research, 188(2), 169-180 (2017-06-10)
Breast cancer is the most common malignancy diagnosed among women and represents a heterogeneous group of subtypes. Radiation therapy is a critical component of treatment for breast cancer patients. However, little is known about radiation response among these intrinsic subtypes.
Sara Cuadrado-Castano et al.
Molecular cancer therapeutics, 14(5), 1247-1258 (2015-03-13)
Newcastle disease virus (NDV) is considered a promising agent for cancer therapy due to its oncolytic properties. These include preferential replication in transformed cells, induction of innate and adaptive immune responses within tumors, and cytopathic effects in infected tumor cells
K Mizrahi et al.
Bone marrow transplantation, 49(7), 942-949 (2014-04-30)
The influence of TNF-α and Fas-ligand (FasL) on viability and function was evaluated in fresh- and expanded-umbilical cord blood (UCB) cells. CD34(+) progenitors and T cells display outstanding survival, whereas ~30% and >50% B lymphocytes and myeloid cells undergo spontaneous
Janet K Horton et al.
Radiation research, 184(5), 456-469 (2015-10-22)
Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique