Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU056991

Sigma-Aldrich

MISSION® esiRNA

targeting human CLOCK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCACACATAGGCCATCTTATGAAGATAGAGTTTGTTTTGTAGCTACTGTCAGGTTAGCTACACCTCAGTTCATCAAGGAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTTTCTGTTTCTAGATCACAGGGCACCACCCATAATAGGGTATTTGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTATCATGTGGATGACCTAGAAAATTTGGCAAAATGTCATGAGCACTTAATGCAATATGGGAAAGGCAAATCATGTTATTATAGGTTCCTGACTAAGGGGCAACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTACCATCAGTGGAATTCAAGGCCAGAGTTTATTGTTTGTACTCACACTGTAGTAAGTTATGCAGAAGTTAGGGCTGAAAGACGACG

Numéro d'accès Ensembl | humain

ENSG00000134852

Numéro d'accès NCBI

NM_004898

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLOCK(9575) , CLOCK(9575)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pan Jiang et al.
International journal of molecular medicine, 46(6), 2216-2224 (2020-10-31)
Circadian rhythm plays an important role in diverse physiological processes. Abnormal expression of circadian rhythm genes is associated with increased risk of disease, including different types of cancer. The cancer stem cell (CSC) hypothesis suggests that there is a small
Qixia Jiang et al.
Acta biochimica et biophysica Sinica, 50(9), 869-879 (2018-08-21)
To explore the association between clock circadian regulator circadian locomotor output cycles kaput gene (CLOCK) and the forming of atherosclerotic plaques and its underlying mechanisms, mouse aortic endothelial cells (MAECs) and atherosclerosis (AS) mouse model were recruited for our study.
Soon Young Shin et al.
Scientific reports, 7(1), 11175-11175 (2017-09-13)
The juice of Ageratum houstonianum is used in folk medicine as an external wound healing aid for skin injuries. However, the active component of A. houstonianum and its mode of action in skin wound healing has not been investigated. This
Ursula Loizides-Mangold et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(41), E8565-E8574 (2017-10-05)
Circadian clocks play an important role in lipid homeostasis, with impact on various metabolic diseases. Due to the central role of skeletal muscle in whole-body metabolism, we aimed at studying muscle lipid profiles in a temporal manner. Moreover, it has
Laurent Perrin et al.
eLife, 7 (2018-04-17)
Circadian regulation of transcriptional processes has a broad impact on cell metabolism. Here, we compared the diurnal transcriptome of human skeletal muscle conducted on serial muscle biopsies in vivo with profiles of human skeletal myotubes synchronized in vitro. More extensive

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique