Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU047961

Sigma-Aldrich

MISSION® esiRNA

targeting human GRK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAGGTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGGGGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAGTGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGCATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCT

Numéro d'accès Ensembl | humain

ENSG00000173020

Numéro d'accès NCBI

NM_001619

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GRK2(156) , ADRBK1(156)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuezhi Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 110, 834-843 (2018-12-18)
CP-25 attenuates arthritis progression in animal models by inhibiting G protein-coupled receptor kinase 2 (GRK2) membrane expression. This study compared groups treated with high-dose methotrexate (MTX)/leflunomide (LEF) and CP-25 combined with low-dose MTX/LEF in an adjuvant-induced arthritis (AA) rat model
Xuezhi Yang et al.
Cells, 8(12) (2019-12-11)
Rheumatoid arthritis (RA) is characterized by the massive infiltration of various chronic inflammatory cells in synovia. In synovial fluid of patients with RA, M1 macrophages are dominant among all subtypes of macrophages, the mechanisms of macrophages polarization imbalance in RA
Jie Xu et al.
Nature communications, 8, 14002-14002 (2017-01-17)
β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3
Jing Cheng et al.
The Journal of clinical investigation, 130(2), 1036-1051 (2020-01-22)
Antigen receptor-dependent (AgR-dependent) stimulation of the NF-κB transcription factor in lymphocytes is a required event during adaptive immune response, but dysregulated activation of this signaling pathway can lead to lymphoma. AgR stimulation promotes assembly of the CARMA1-BCL10-MALT1 complex, wherein MALT1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique