Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU043671

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP3, SENP3-EIF4A1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTCCCTGAAAAGGTGCATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCGGTTATGATGGGGTGAAAAGGTGGACCAAAAACGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCATCCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTATTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGCATATTGCCAAGTATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTTACTTCAAAATGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCAGCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACTGCAAA

Numéro d'accès Ensembl | humain

ENSG00000161956

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SENP3(26168) , SENP3(26168)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jia Luo et al.
The Journal of toxicological sciences, 42(5), 529-538 (2017-07-28)
Increased post-translational modification of proteins by SUMO-2/3 is a cytoprotective response against cell stress induced by ischaemia and reperfusion. However, it is still unclear what other cell stressors trigger protein SUMOylation, what mechanisms enhance and maintain the enhanced SUMOylation, and
Y Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2778-2786 (2018-05-18)
To investigate whether SENP3 protects H9C2 cells from apoptosis triggered by H/R through the signal transducer and activator of transcription 3 (STAT3) pathway. Male C57BL mice were cultured and mouse models of myocardial I/RI were established. At the same time
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Chun-Jie Huang et al.
Biochimica et biophysica acta, 1864(7), 1195-1206 (2017-03-21)
Understanding the mechanisms underlying abnormal egg production and pregnancy loss is significant for human fertility. SENP7, a SUMO poly-chain editing enzyme, has been regarded as a mitotic regulator of heterochromatin integrity and DNA repair. Herein, we report the roles of
Arnab Nayak et al.
Cell reports, 27(9), 2725-2736 (2019-05-30)
Precise assembly of the sarcomere, a force-generating unit in striated muscles, is critical for muscle contraction. Defective sarcomere organization is linked to myopathies and cachexia. The molecular mechanisms concerning sarcomere assembly are poorly understood. Here, we report that the SUMO-specific
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique