Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU037061

Sigma-Aldrich

MISSION® esiRNA

targeting human SALL4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGAAAGTGAGGGTGGACCCACACTCCCTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCCCTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCACCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCAAGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAGCCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCATTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGCAGCAACATATTCGGATGCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Amireza Hesari et al.
Journal of cellular biochemistry, 120(6), 9392-9399 (2018-12-07)
Breast cancer is the most prevalent cancers worldwide and causes a significant amount of deaths annually. Spalt-like transcription factor 4 is known as a transcription factor, which has an important role in the proliferation of cancerous cells. Small interfering RNA
Mei Wang et al.
Journal of cellular biochemistry, 120(9), 15027-15037 (2019-04-23)
MicroRNAs (miRNAs) play pivotal roles in modulating key biological processes in gastric cancer (GC). As a newly identified miRNA, the function and potential mechanism of miR-188-5p in GC has not been thoroughly elucidated. Here, quantitative real-time polymerase chain reaction detection
Dengfeng Zhang et al.
Oncology research, 25(5), 763-771 (2016-12-17)
Sal-like protein 4 (SALL4) is a zinc finger transcription factor that has been reported to be aberrantly expressed in several human malignancies and identified as an oncogene. However, the potential role of SALL4 in osteosarcoma remains to be elucidated. In
AmirReza Hesari et al.
Journal of cellular biochemistry (2019-02-17)
Colorectal cancer (CRC) is known as the third most common malignancies among men and women and is also the second leading cause of cancer-related deaths worldwide. It has been indicated that a variety of risk factors are involved in the
Kol Jia Yong et al.
Oncotarget, 7(46), 75425-75440 (2016-10-06)
The overall survival of lung cancer patients remains dismal despite the availability of targeted therapies. Oncofetal protein SALL4 is a novel cancer target. We herein report that SALL4 was aberrantly expressed in a subset of lung cancer patients with poor

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique