Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU034721

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAA

Numéro d'accès Ensembl | humain

ENSG00000100097

Numéro d'accès NCBI

NM_002305

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LGALS1(3956) , LGALS1(3956)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS
XET
GCT
IRS
ANS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xue Zhu et al.
Acta biochimica et biophysica Sinica, 48(5), 462-467 (2016-03-31)
Carcinoma-associated fibroblasts (CAFs) play central roles in facilitating tumor progression and metastasis in breast cancer. Galectin-1 (Gal-1), a marker of CAFs, was previously reported to be associated with tumorigenesis and metastasis of various types of tumors. The aim of this
Dong Qian et al.
Cancer letters, 397, 43-51 (2017-03-25)
Galectin-1, mainly expressed in activated pancreatic stellate cells (PSCs), is involved in many important cancer-related processes. However, very little is known how Galectin-1 modulates PSCs and subsequently impacts pancreatic cancer cells (PCCs). Our chemokine antibody array and in vitro studies demonstrates
Noor Al-Obaidi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 373-387 (2018-07-06)
Chronic exposure of tubular renal cells to high glucose contributes to tubulointerstitial changes in diabetic nephropathy. In the present study, we identified a new fibrosis gene called galectin-1 (Gal-1), which is highly expressed in tubular cells of kidneys of type
Bing Yan et al.
International journal of biological sciences, 12(7), 850-860 (2016-06-18)
Lung cancer is the leading cause of cancer mortality around the world. Despite advances in the targeted therapy, patients with lung squamous cell carcinoma(SCC) still benefit few from it, and the search for potential effective therapies is imperative. Here, we
Jung-Hwan Baek et al.
Cell death & disease, 12(1), 66-66 (2021-01-13)
Galectin-1 contains a carbohydrate-recognition domain (CRD) as a member of the lectin family. Here, we investigated whether galectin-1 regulates adipogenesis and lipid accumulation. Galectin-1 mRNA is highly expressed in metabolic tissues such as the muscle and adipose tissues. Higher mRNA
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique