Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU030131

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAG

Numéro d'accès Ensembl | humain

ENSG00000134318

Numéro d'accès NCBI

NM_004850

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ROCK2(9475) , ROCK2(9475)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sarah Theresa Boyle et al.
Nature cell biology, 22(7), 882-895 (2020-05-27)
It is well accepted that cancers co-opt the microenvironment for their growth. However, the molecular mechanisms that underlie cancer-microenvironment interactions are still poorly defined. Here, we show that Rho-associated kinase (ROCK) in the mammary tumour epithelium selectively actuates protein-kinase-R-like endoplasmic
Cecilia Dyberg et al.
Cancers, 12(1) (2020-01-01)
Medulloblastoma is one of the most common malignant brain tumor types in children, with an overall survival of 70%. Mortality is associated with metastatic relapsed tumors. Rho-associated kinases (ROCKs), important for epithelial-mesenchymal transition (EMT) and proper nervous system development, have
Ye Wang et al.
PloS one, 11(1), e0146646-e0146646 (2016-01-09)
Some recent studies suggest that multiple miRNAs might regulate neurogenic transdifferentiation of mesenchymal stromal cells (MSCs). In the present study, we hypothesized that the miR-124 can repress the expression of RhoA upon the neurogenesis of adipose derived MSCs (ADMSCs). MiRNA
Ming-Ming Ma et al.
British journal of pharmacology, 173(3), 529-544 (2015-11-13)
Angiotensin II (AngII) induces migration and growth of vascular smooth muscle cell (VSMC), which is responsible for vascular remodelling in some cardiovascular diseases. Ang II also activates a Cl(-) current, but the underlying mechanism is not clear. The A10 cell
Ji-Gang Zhang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1113-1125 (2019-02-20)
Vasculogenic mimicry (VM) results in the formation of an alternative circulatory system that can improve the blood supply to multiple malignant tumors, including hepatocellular carcinoma (HCC). However, the potential mechanisms of RhoC/ROCK in VM have not yet been investigated in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique