Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU019271

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 272-279 (2016-12-05)
FABP4 is widely expressed in both normal and pathologic tissues. It promotes cell proliferation, survival and migration of endothelial cells, and therefore, angiogenesis. However, the role of FABP4 in hemangioma or hemangioma endothelial cells (HemECs) has not been explored. In
Mingguo Huang et al.
Oncotarget, 8(67), 111780-111794 (2018-01-18)
Fatty acid binding protein 4 (FABP4) is an abundant protein in adipocytes, and its production is influenced by high-fat diet (HFD) or obesity. The prostate stromal microenvironment induces proinflammatory cytokine production, which is key for the development and progression of
U Harjes et al.
Oncogene, 36(7), 912-921 (2016-08-30)
Fatty acid binding protein 4 (FABP4) is a fatty acid chaperone, which is induced during adipocyte differentiation. Previously we have shown that FABP4 in endothelial cells is induced by the NOTCH1 signalling pathway, the latter of which is involved in
Sanjay Basak et al.
Molecular and cellular biochemistry, 437(1-2), 55-64 (2017-06-18)
Adequate placental angiogenesis is critical for the establishment of the placental circulation and thus for normal feto-placental growth and development. Fatty acid-binding protein-4 (FABP4) plays a pro-angiogenic role in endothelial cells; however, very little information is available in placental first
Rebecca F Rogers et al.
Cancer research, 80(8), 1735-1747 (2020-03-13)
Checkpoint kinase 1 (CHK1) is a key mediator of the DNA damage response that regulates cell-cycle progression, DNA damage repair, and DNA replication. Small-molecule CHK1 inhibitors sensitize cancer cells to genotoxic agents and have shown single-agent preclinical activity in cancers

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique