Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU011941

Sigma-Aldrich

MISSION® esiRNA

targeting human CLPP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTTCCTGCAATCCGAGAGCAACAAGAAGCCCATCCACATGTACATCAACAGCCCTGGTGGTGTGGTGACCGCGGGCCTGGCCATCTACGACACGATGCAGTACATCCTCAACCCGATCTGCACCTGGTGCGTGGGCCAGGCCGCCAGCATGGGCTCCCTGCTTCTCGCCGCCGGCACCCCAGGCATGCGCCACTCGCTCCCCAACTCCCGTATCATGATCCACCAGCCCTCAGGAGGCGCCCGGGGCCAAGCCACAGACATTGCCATCCAGGCAGAGGAGATCATGAAGCTCAAGAAGCAGCTCTATAACATCTACGCCAAGCACACCAAACAGAGCCTGCAGGTGATCGAGTCCGCCATGGAGAGGGACCGCTACATGAGCCCCATGGAGGCCCAGGAGTTTGGCATCTTAGACAAGGTTCTGGTCCACCCTCCCCAGGACGGTGAGGATGAGCCCACGCTGGTGCAGAAGGAGCCTGTAGAAGCAGCGCCGGCAGCAGAACCTGTCCCAGCTAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kayoko Eguchi et al.
Biochemical and biophysical research communications, 520(1), 128-135 (2019-10-05)
Cells require proper regulation of energy metabolism to maintain cellular homeostasis. Pyruvate dehydrogenase (PDH) is a metabolic enzyme that converts pyruvate into acetyl-CoA, connecting glycolysis to the TCA cycle, thus regulating cellular energy metabolism. PDH is involved in multiple cellular
Di Hu et al.
Acta neuropathologica, 137(6), 939-960 (2019-03-17)
Both α-Synuclein (αSyn) accumulation and mitochondrial dysfunction have been implicated in the pathology of Parkinson's disease (PD). Although studies suggest that αSyn and its missense mutant, A53T, preferentially accumulate in the mitochondria, the mechanisms by which αSyn and mitochondrial proteins

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique