Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU009241

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB6 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCCATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTTATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAGCTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGAACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGCCATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACAGCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAGCCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Robert J Slack et al.
Pharmacology, 97(3-4), 114-125 (2016-01-07)
A20FMDV2 is a peptide derived from the foot-and-mouth disease virus with a high affinity and selectivity for the alpha-v beta-6 (αvβ6) arginyl-glycinyl-aspartic acid (RGD)-binding integrin. It has been shown to be an informative tool ligand in pre-clinical imaging studies for
Jiarui Bi et al.
Cytokine, 114, 135-142 (2018-11-24)
Epithelial αvβ6 integrin participates in immune surveillance in many organs, including the gastrointestinal track. Expression of αvβ6 integrin is reduced in the junctional epithelium of the gingiva in periodontal diseases, and mutations in the ITGB6 gene are associated with these
Jiarui Bi et al.
Scientific reports, 7(1), 4411-4411 (2017-07-02)
Periodontal diseases manifest by the formation of deep pockets between the gingiva and teeth where multispecies bacterial biofilms flourish, causing inflammation and bone loss. Epithelial cell receptor αvβ6 integrin that regulates inflammation by activating the anti-inflammatory cytokine transforming growth factor-β1
Runhong Han et al.
JCI insight, 4(7) (2019-04-05)
Chronic tubulointerstitial injury impacts the prognosis of focal segmental glomerulosclerosis (FSGS). We found that the level of versican V1 was increased in tubular cells of FSGS patients. Tubular cell-derived versican V1 induced proliferation and collagen synthesis by activating the CD44/Smad3

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique