Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU009051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAA

Numéro d'accès Ensembl | humain

ENSG00000168209

Numéro d'accès NCBI

NM_019058

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DDIT4(54541) , DDIT4(54541)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Aistė Savukaitytė et al.
Cancer management and research, 13, 1123-1133 (2021-02-13)
Mutations within genes encoding components of the PI3K/AKT/mTOR (phosphoinositide 3-kinase/protein kinase B/mechanistic target of rapamycin) signaling axis frequently activate the pathway in breast cancer, making it an attractive therapeutic target. Inhibition of mTORC1 (mechanistic target of rapamycin complex 1) activity
Bowen Wang et al.
Investigative ophthalmology & visual science, 60(8), 2836-2847 (2019-07-03)
To assess how DNA damage-inducible transcript 4 (DDIT4) and autophagic flux are altered in dry eye disease and reveal the underlying mechanisms. C57BL/6 mice were exposed to desiccating stress (subcutaneous scopolamine [0.5 mg/0.2 mL] 3 times a day, humidity <
Peng Li et al.
Biochemical and biophysical research communications, 519(1), 179-185 (2019-09-09)
Oxidative stress plays a significant role involved in myocardial ischemia/reperfusion (MI/R) injury. The regulated in development and DNA damage response 1 (REDD1) is an mTORC1 inhibitor participating in response to hypoxia and oxidative stress. However, whether and how REDD1 is
Oscar Alvarez-Garcia et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(7), 1418-1428 (2017-03-24)
Regulated in development and DNA damage response 1 (REDD1) is an endogenous inhibitor of mechanistic target of rapamycin (mTOR) that regulates cellular stress responses. REDD1 expression is decreased in aged and osteoarthritic (OA) cartilage, and it regulates mTOR signaling and
Emilie Jaune et al.
Cell death & disease, 12(1), 64-64 (2021-01-13)
In the search of biguanide-derived molecules against melanoma, we have discovered and developed a series of bioactive products and identified the promising new compound CRO15. This molecule exerted anti-melanoma effects on cells lines and cells isolated from patients including the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique