Skip to Content
Merck
All Photos(1)

Key Documents

EHU129811

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAACTGTCACACCACAACTACCACCTTATGGCGCAGAAACGCCGAGGGTGAACCCGTGTGCAATGCTTGTGGACTCTACATGAAACTCCATGGGGTGCCCAGACCACTTGCTATGAAAAAAGAGGGAATTCAAACCAGGAAACGAAAACCTAAGAACATAAATAAATCAAAGACTTGCTCTGGTAATAGCAATAATTCCATTCCCATGACTCCAACTTCCACCTCTTCTAACTCAGATGATTGCAGCAAAAATACTTCCCCCACAACACAACCTACAGCCTCAGGGGCGGGTGCCCCGGTGATGACTGGTGCGGGAGAGAGCACCAATCCCGAGAACAGCGAGCTCAAGTATTCGGGTCAAGATGGGCTCTACATAGGCGTCAGTCTCGCCTCGCCGGCCGAAGTCACGTCCTCCGTGCGACCGGATTCCTGGTGCGCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ruishuang Ma et al.
Cancer biology & therapy, 20(9), 1206-1212 (2019-05-17)
Autophagy plays a complicated role in tumorigenesis, and the effects of autophagy in drug resistance have not been fully known. The aim of this study was to evaluate autophagy activity in lung cancer cells derived from different origins and explore
Mao Guoping et al.
Oncology research, 26(7), 1023-1029 (2018-01-13)
Recent studies have suggested that the dysregulation of microRNAs (miRNAs) plays a critical role in the progression of human cancers, including gastric cancer (GC). miR-143 had been reported to function as a tumor suppressor in GC. However, the exact molecular
Chellappagounder Thangavel et al.
The American journal of pathology, 189(4), 847-867 (2019-02-02)
Caveolins (CAVs) are structural proteins of caveolae that function as signaling platforms to regulate smooth muscle contraction. Loss of CAV protein expression is associated with impaired contraction in obstruction-induced bladder smooth muscle (BSM) hypertrophy. In this study, microarray analysis of
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Holly Brunton et al.
Cell reports, 31(6), 107625-107625 (2020-05-14)
Pancreatic ductal adenocarcinoma (PDAC) can be divided into transcriptomic subtypes with two broad lineages referred to as classical (pancreatic) and squamous. We find that these two subtypes are driven by distinct metabolic phenotypes. Loss of genes that drive endodermal lineage

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service