Skip to Content
Merck
All Photos(1)

Key Documents

EHU069091

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP2A2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cheol Yi Hong et al.
Experimental & molecular medicine, 48(8), e253-e253 (2016-08-20)
The migration of dendritic cells (DCs) to secondary lymphoid organs depends on chemoattraction through the interaction of the chemokine receptors with chemokines. However, the mechanism of how lymphoid chemokines attract DCs to lymphoid organs remains unclear. Here, we demonstrate the
Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Eduardo Izquierdo-Torres et al.
Molecular carcinogenesis, 56(7), 1703-1711 (2017-02-06)
The Ca
Feng Huang et al.
Journal of cancer research and clinical oncology, 140(11), 1835-1848 (2014-06-19)
This study was designed to investigate the role of PDGF-DD secreted by gastric cancer-derived mesenchymal stem cells (GC-MSCs) in human gastric cancer progression. Gastric cancer cells were indirectly co-cultured with GC-MSCs in a transwell system. The growth and migration of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service