Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU006671

Sigma-Aldrich

MISSION® esiRNA

targeting human RNMT

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGACATGATGCTGAGAAATGCGTGTGAGAGACTTAGCCCTGGGGGCTATTTTATTGGTACTACTCCCAATAGCTTTGAATTGATAAGACGCCTTGAAGCTTCAGAAACAGAATCATTTGGAAATGAAATATATACTGTGAAATTTCAGAAGAAAGGAGATTATCCTTTATTTGGCTGCAAATATGACTTCAACTTGGAAGGTGTTGTGGATGTTCCTGAATTCTTGGTCTATTTTCCATTGCTAAATGAAATGGCAAAGAAGTACAATATGAAACTAGTCTACAAAAAAACATTTCTGGAATTCTACGAAGAAAAGATTAAGAACAATGAAAATAAAATGCTCTTAAAACGAATGCAGGCCTTGGAGCCATATCCTGCAAATGAGAGTTCTAAACTTGTCTCTGAGAAGGTGGATGACTATGAACATGCAGCAAAGTACATGAAGAACAGTCAAGTAAGGTTACCTTTGGGAACCTTAAGTAAATCAGAATGGGAAGCTACAAGTATTTACTTGGTGTTTGCCTTTGAGAAACAGCA

Ensembl | human accession no.

ENSG00000101654

NCBI accession no.

NM_003799

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RNMT(8731) , RNMT(8731)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service