Skip to Content
Merck
All Photos(1)

Key Documents

EHU095401

Sigma-Aldrich

MISSION® esiRNA

targeting human PCM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTGTTCAATGAATTGGCTTTCTTTAAGCTTATGCAAGATTTGGATAATAATAGTATAACTGTTAAACAGAGATGCAAAAGGAAAATAGAAGCAACTGGAGTGATACAATCTTGTGCCAAAGAGGCTAAAAGGATTCTTGAAGATCATGGCTCACCTGCTGGAGAGATTGATGATGAAGACAAAGACAAGGATGAAACTGAAACAGTTAAGCAGACTCAAACATCTGAGGTGTATGATGGTCCCAAAAATGTAAGATCTGATATTTCTGATCAAGAGGAAGATGAAGAAAGTGAAGGATGTCCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xin Li et al.
Nature communications, 8, 14866-14866 (2017-04-01)
Defective centrosome duplication is implicated in microcephaly and primordial dwarfism as well as various ciliopathies and cancers. Yet, how the centrosome biogenesis is regulated remains poorly understood. Here we report that the X-linked deubiquitinase USP9X is physically associated with centriolar
H Kubra Gurkaslar et al.
Cell reports, 31(6), 107630-107630 (2020-05-14)
Centrosomes function in key cellular processes ranging from cell division to cellular signaling. Their dysfunction is linked to cancer and developmental disorders. Here, we identify CCDC57 as a pleiotropic regulator of centriole duplication, mitosis, and ciliogenesis. Combining proximity mapping with

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service