Skip to Content
Merck
All Photos(1)

Key Documents

EHU076421

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCATGGAGGTACAGACAAAGAAAGTTCGAAAAGTTCCTCCAGGTTTGCCATCTTCAGTCTATGCTCCATCAGCAAGCACTGCCGACTACAATAGGGACTCGCCAGGCTATCCTTCCTCCAAACCAGCAACCAGCACTTTCCCTAGCTCCTTCTTCATGCAAGATGGCCATCACAGCAGTGACCCTTGGAGCTCCTCCAGTGGGATGAATCAGCCTGGCTATGCAGGAATGTTGGGCAACTCTTCTCATATTCCACAGTCCAGCAGCTACTGTAGCCTGCATCCACATGAACGTTTGAGCTATCCATCACACTCCTCAGCAGACATCAATTCCAGTCTTCCTCCGATGTCCACTTTCCATCGTAGTGGTACAAACCATTACAGCACCTCTTCCTGTACGCCTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Stephen Gadomski et al.
Cell reports, 31(4), 107572-107572 (2020-04-30)
Investigating mechanisms that regulate endothelial cell (EC) growth and survival is important for understanding EC homeostasis and how ECs maintain stem cell niches. We report here that targeted loss of Id genes in adult ECs results in dilated, leaky sinusoids
Menglan Cheng et al.
Scientific reports, 5, 10752-10752 (2015-07-18)
Dendritic cells (DCs) are sentinels of the immune system and comprise two distinct subsets: conventional DCs (cDCs) and plasmacytoid DCs (pDCs). Human pDCs are distinguished from mouse pDCs phenotypically and functionally. Basic helix-loop-helix protein E2-2 is defined as an essential

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service