Skip to Content
Merck
All Photos(1)

Key Documents

EMU046741

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ik

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
£188.00
50 μG
£334.00

£188.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
£188.00
50 μG
£334.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

£188.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAATGCTATCCAGCCACGATGGATGACATGGCTGTAGATAGTGATGAAGAGGTAGATTATAGCAAAATGGACCAGGGTAACAAGAAGGGTCCCTTAGGCCGCTGGGACTTCGATACTCAGGAGGAATACAGCGAGTACATGAACAACAAGGAGGCTCTGCCCAAGGCTGCATTCCAGTATGGCATCAAGATGTCTGAAGGACGGAAAACCAGACGATTCAAAGAAACCAATGATAAGGCAGAGCTTGATCGACAGTGGAAGAAAATAAGTGCAATCATTGAGAAGAGGAAGAGGATGGAAGCAGATGGGGTCGAAGTGAAAAGACCAAAGTACTAATCTCTAGTTCCAGCTGTCACCACGTGGCTGTTCTTAGTTGCTTGCTTCTACAATTCCTCAGACGGTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liyan Hu et al.
Biomarker research, 1(1), 11-11 (2013-11-21)
IK is a nuclear protein containing a unique domain named RED due to the presence of a repetitive arginine (R), aspartic (E), and glutamic acid (D) sequence. To date, the function of this protein remains largely unknown despite of a
Anna Li et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 32(7), 1406-1420 (2017-04-04)
Vitamin D is involved in a range of physiological processes and its active form and analogs have been used to treat diseases such as osteoporosis. Yet how vitamin D executes its function remains unsolved. Here we show that the active

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service