Skip to Content
Merck
All Photos(1)

Key Documents

EMU043231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyn

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
£188.00
50 μG
£334.00

£188.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
£188.00
50 μG
£334.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

£188.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGCTCCTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGCCAAACCACCAAAGGTGCCTACTCACTTTCCATCCGTGATTGGGATGATATGAAAGGGGACCACGTCAAACATTATAAAATCCGCAAGCTTGACAATGGTGGATACTATATCACAACGCGGGCCCAGTTTGAAACACTTCAGCAACTGGTACAGCATTACTCAGAGAAAGCTGATGGTTTGTGTTTTAACTTAACTGTGGTTTCATCAAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCACGTGACTCGTTGTTTCTGGAGAAGAAGCTGGGGCAGGGGTGTTTCGCTGAAGTGTGGCTTGGTACCTGGAATGGAAATACAAAAGTAGCCATAAAGACCCTTAAGCCAGGCACCATGTCTCCGGAGTCCTTCCTGGAGGAGGCGCAGATCATGAAGAAGCTGAAGCATGACAAGCTGGTGCAGCTCTACGCGGTCGTGTCTGAGGAGCCCATTTACATCGTCACGGAGTACATGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service