Skip to Content
Merck
All Photos(1)

Key Documents

EHU146741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAPDH

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
£188.00
50 μG
£334.00

£188.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
£188.00
50 μG
£334.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

£188.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Suzan Ruijtenberg et al.
Nature structural & molecular biology, 27(9), 790-801 (2020-07-15)
Small interfering RNAs (siRNAs) promote RNA degradation in a variety of processes and have important clinical applications. siRNAs direct cleavage of target RNAs by guiding Argonaute2 (AGO2) to its target site. Target site accessibility is critical for AGO2-target interactions, but
Annalucia Carbone et al.
Stem cells international, 2018, 1203717-1203717 (2018-03-14)
We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein.
R G Morgan et al.
Scientific reports, 8(1), 7952-7952 (2018-05-23)
3D tissue culture provides a physiologically relevant and genetically tractable system for studying normal and malignant human tissues. Despite this, gene-silencing studies using siRNA has proved difficult. In this study, we have identified a cause for why traditional siRNA transfection
Joshua A Chu-Tan et al.
Molecular vision, 26, 48-63 (2020-03-14)
The use of small non-coding nucleic acids, such as siRNA and miRNA, has allowed for a deeper understanding of gene functions, as well as for development of gene therapies for complex neurodegenerative diseases, including retinal degeneration. For effective delivery into
Fabienne Wagner et al.
PloS one, 14(10), e0218303-e0218303 (2019-10-24)
Cristae architecture is important for the function of mitochondria, the organelles that play the central role in many cellular processes. The mitochondrial contact site and cristae organizing system (MICOS) together with the sorting and assembly machinery (SAM) forms the mitochondrial

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service