Skip to Content
Merck
All Photos(1)

Documents

EHU107281

Sigma-Aldrich

MISSION® esiRNA

targeting human ESRRA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGG

Ensembl | human accession no.

ENSG00000173153

NCBI accession no.

NM_004451

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ESRRA(2101) , ESRRA(2101)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiumin Huang et al.
Cell adhesion & migration, 12(6), 538-547 (2018-05-22)
Estrogenic signals have been suggested to be important for the tumorigenesis and progression of endometrial cancer (EC) cells. Our present data showed that estrogen related receptor alpha (ERRα), while not ERRβ or ERRγ, was significantly elevated in EC cells and
Peng Chen et al.
Journal of cellular biochemistry, 118(1), 74-81 (2016-05-28)
Curcumin has demonstrated valuable therapeutic potential against a variety of human cancers including osteosarcoma. However, the molecular mechanisms underlying its anti-tumor effect remain to be poorly understood. By RNA sequence profiling, we found that curcumin significantly down-regulates the expression of
Ankana Tiwari et al.
Scientific reports, 5, 17621-17621 (2015-12-08)
The ESRRA gene encodes a transcription factor and regulates several genes, such as WNT11 and OPN, involved in tumorigenesis. It is upregulated in several cancers, including OSCC. We have previously shown that the tumor suppressor miR-125a targets ESRRA, and its
Kaori Yoriki et al.
Scientific reports, 9(1), 6697-6697 (2019-05-02)
Estrogen-related receptor alpha (ERRα), which shares structural similarities with estrogen receptors, is associated with tumor progression in endometrial cancer, but little is known about the detailed underlying mechanism. We investigated whether ERRα, in cooperation with peroxisome proliferator-activated receptor gamma coactivator

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service