Skip to Content
Merck
All Photos(1)

Key Documents

EHU094041

Sigma-Aldrich

MISSION® esiRNA

targeting human MLXIPL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCTCTTCTCTCCCAGGTTTCCCTTCCCCACCGTCCCTCCTGCCCCAGGAGTGTCTCCGCTGCCTGCTCCTGCAGCCTTCCCACCCACCCCACAGTCTGTCCCCAGCCCAGCCCCCACCCCCTTCCCCATAGAGCTTCTACCCTTGGGGTATTCGGAGCCTGCCTTTGGGCCTTGCTTCTCCATGCCCAGAGGCAAGCCCCCCGCCCCATCCCCTAGGGGACAGAAAGCCAGCCCCCCTACCTTAGCCCCTGCCACTGCCAGTCCCCCCACCACTGCGGGGAGCAACAACCCCTGCCTCACACAGCTGCTCACAGCAGCTAAGCCGGAGCAAGCCCTGGAGCCACCACTTGTATCCAGCACCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nan Chen et al.
Journal of cellular physiology, 236(1), 625-640 (2020-06-26)
Lipid deposition caused by the disorder of renal lipid metabolism is involved in diabetic nephropathy (DN). Carbohydrate response element-binding protein (ChREBP) is a key transcription factor in high glucose-induced cellular fat synthesis. At present, the regulation and mechanism of ChREBP
Susumu Suzuki et al.
Endocrine journal, 67(3), 335-345 (2019-12-10)
Carbohydrate response element binding protein (ChREBP), a glucose responsive transcription factor, mainly regulates expression of genes involved in glucose metabolism and lipogenesis. Recently, ChREBP is speculated to be involved in the onset and progression of diabetic nephropathy (DN). However, there
Can Cai et al.
International journal of molecular medicine, 42(3), 1215-1228 (2018-05-23)
Non‑alcoholic fatty liver disease (NAFLD) is a manifestation of metabolic syndrome in the liver and is closely associated with diabetes; however, its pathogenesis remains to be elucidated. Carbohydrate responsive element binding protein (ChREBP), the hub of glucolipid metabolism, regulates the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service