Skip to Content
Merck
All Photos(1)

Documents

EHU081481

Sigma-Aldrich

MISSION® esiRNA

targeting human MITF

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC

Ensembl | human accession no.

ENSG00000187098

NCBI accession no.

NM_000248

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MITF(4286) , MITF(4286)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hua Chen et al.
International journal of clinical and experimental pathology, 13(4), 730-737 (2020-05-02)
Coronary atherosclerosis affects human health all over the world. PON1 was found to be associated with coronary atherosclerosis but the specific mechanism is still unclear. Non-coding RNA plays an important role in many diseases. In recent years, studies have focused
Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various
Paola Falletta et al.
Genes & development, 31(1), 18-33 (2017-01-18)
The intratumor microenvironment generates phenotypically distinct but interconvertible malignant cell subpopulations that fuel metastatic spread and therapeutic resistance. Whether different microenvironmental cues impose invasive or therapy-resistant phenotypes via a common mechanism is unknown. In melanoma, low expression of the lineage
Yue Chang et al.
Cancer cell international, 21(1), 29-29 (2021-01-09)
Endometrial cancer is an invasive gynecological cancer prevalent in the world. The pathogenesis of endometrial cancer is related to multiple levels of regulation, referring to oestrogen, tumor-suppressor gene (e.g. PTEN) or microRNAs (e.g. miR-23a and miR-29b). Metapristone is a hormone-related
Jijun Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 581-593 (2017-11-18)
Increasing evidence indicates that Huaier extract has promising therapeutic effects against cancer. However, the mechanisms that underlie its anti-tumor effects remain unclear. In recent years, various studies have shown that long noncoding RNAs (lncRNAs) play a critical role in the
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service