Skip to Content
Merck
All Photos(1)

Key Documents

EHU077701

Sigma-Aldrich

MISSION® esiRNA

targeting human MALT1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATGGTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Leonie Konczalla et al.
International journal of cancer, 146(6), 1618-1630 (2019-07-11)
MALT1 is a key mediator of NF-κB signaling and a main driver of B-cell lymphomas. Remarkably, MALT1 is expressed in the majority of pancreatic ductal adenocarcinomas (PDACs) as well, but absent from normal exocrine pancreatic tissue. Following, MALT1 shows off
Matija Hedl et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(37), 13451-13456 (2014-09-10)
Inflammatory diseases are characterized by dysregulated cytokine production. Altered functions for most risk loci, including the inflammatory bowel disease and leprosy-associated tumor necrosis factor ligand superfamily member 15 (TNFSF15) region, are unclear. Regulation of pattern-recognition-receptor (PRR)-induced signaling and cytokines is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service