Skip to Content
Merck
All Photos(1)

Key Documents

EHU076591

Sigma-Aldrich

MISSION® esiRNA

targeting human ROBO1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
£188.00
50 μG
£334.00

£188.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
£188.00
50 μG
£334.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

£188.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATGGAGTCCTCGTTTCAACCCAAGACTCTCGAATCAAACAGTTGGAGAATGGAGTACTGCAGATCCGATATGCTAAGCTGGGTGATACTGGTCGGTACACCTGCATTGCATCAACCCCCAGTGGTGAAGCAACATGGAGTGCTTACATTGAAGTTCAAGAATTTGGAGTTCCAGTTCAGCCTCCAAGACCTACTGACCCAAATTTAATCCCTAGTGCCCCATCAAAACCTGAAGTGACAGATGTCAGCAGAAATACAGTCACATTATCGTGGCAACCAAATTTGAATTCAGGAGCAACTCCAACATCTTATATTATAGAAGCCTTCAGCCATGCATCTGGTAGCAGCTGGCAGACCGTAGCAGAGAATGTGAAAACAGAAACATCTGCCATTAAAGGACTCAAACCTAATGCAATTTACCTTTTCCTTGTGAGGGCAGCTAAT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zongpu Zhang et al.
Aging, 13(4), 5055-5068 (2021-02-04)
Vasculogenic mimicry (VM), the formation of an alternative microvascular circulation independent of VEGF-driven angiogenesis, is reluctant to anti-angiogenesis therapy for glioma patients. However, treatments targeting VM are lacking due to the poor understanding of the molecular mechanism involved in VM
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service