Skip to Content
Merck
All Photos(1)

Key Documents

EHU064421

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGTCCCCTTCCTCTACCATACAGGCACTATATTGCAATAATGGCTGCAGCTAGACATCAGTGTTCTTACTTAATAAACATGCATGTGGATGAATTTTTAAAGACTGGAGGTATTGCTGAGTGGTTGAATGGTTTGGAATATGTGCCACAAAGACTGAAAAATCTTAATGAAATTAATAAGCTGCTAGCACATCGACCTTGGCTGATCACAAAAGAGCACATTCAGAAACTTGTCAAAACTGGAGAAAATAATTGGTCTCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTTGGTAGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAATTTCTGCGTTTGTGATCTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liuqing Ge et al.
International immunology, 32(6), 421-432 (2020-03-11)
Intestinal macrophages participate in the pathogenesis of inflammatory bowel diseases (IBDs) through secreting pro-inflammatory and tissue-damaging factors as well as inducing the differentiation of T helper 1 (Th1) and T helper 17 (Th17) cells. Elucidating the regulatory mechanisms of intestinal
Yasuo Miki et al.
Neuroscience letters, 684, 35-41 (2018-07-04)
Neurodegenerative disorders such as Parkinson's disease (PD) and dementia with Lewy bodies (DLB) are characterized by impairment of autophagy. Cellular survival is dependent on efficient clearance of phosphorylated α-synuclein, which accumulates as fibrils in the neuronal cytoplasm as Lewy bodies
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service