Skip to Content
Merck
All Photos(1)

Key Documents

EHU039371

Sigma-Aldrich

MISSION® esiRNA

targeting human FSTL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGATGGACACTGCAAAGAGAAGAAATCCGTAAGTCCATCTGCCAGCCCAGTTGTTTGCTATCAGTCCAACCGTGATGAGCTCCGACGTCGCATCATCCAGTGGCTGGAAGCTGAGATCATTCCAGATGGCTGGTTCTCTAAAGGCAGCAACTACAGTGAAATCCTAGACAAGTATTTTAAGAACTTTGATAATGGTGATTCTCGCCTGGACTCCAGTGAATTCCTGAAGTTTGTGGAACAGAATGAAACTGCCATCAATATTACAACGTATCCAGACCAGGAGAACAACAAGTTGCTTAGGGGACTCTGTGTTGATGCTCTCATTGAACTGTCTGATGAAAATGCTGATTGGAAACTCAGCTTCCAAGAGTTTCTCAAGTGCCTCAACCCATCTTTCAACCCTCCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Marco Chi-Chung Lau et al.
Cancer research, 77(21), 5886-5899 (2017-09-09)
Esophageal squamous cell carcinoma (ESCC) has a generally poor prognosis, and molecular markers to improve early detection and predict outcomes are greatly needed. Here, we report that the BMP-binding follistatin-like protein FSTL1 is overexpressed in ESCCs, where it correlates with
Wei Zhang et al.
Scientific reports, 7, 45820-45820 (2017-04-01)
Pulmonary hypertension (PH) remains a life-limiting disease characterized by pulmonary vascular remodelling due to aberrant proliferation and migration of pulmonary artery smooth muscle cells (PASMCs), thus leading to raised pulmonary arterial pressure and right ventricular hypertrophy. Secreted glycoprotein follistatin-like 1
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service