Skip to Content
Merck
All Photos(1)

Key Documents

EHU002251

Sigma-Aldrich

MISSION® esiRNA

targeting human TBC1D5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATAAACAGGGCATGCACGAACTGTTAGCACCTATAGTCTTTGTCCTTCACTGTGACCACCAAGCTTTTCTACATGCCAGTGAGTCTGCACAGCCCAGGCAAGAAATGAAAACTGTCTTGAACCCTGAGTATCTGGAACATGATGCCTATGCAGTGTTCTCACAACTTATGGAAACTGCTGAACCTTGGTTTTCAACTTTTGAGCATGATGGTCAGAAGGGGAAAGAAACACTGATGACTCCCATTCCCTTTGCTAGACCACAAGATTTAGGGCCAACAATTGCTATTGTTACTAAAGTCAACCAGATCCAGGATCATCTACTGAAGAAGCATGATATTGAGCTTTACATGCACTTGAACAGACTAGAAATTGCACCACAGATATATGGGTTAAGGTGGGTGCGGCTGCTATTTGGACGAGAGTTCCCCCTGCAGGACCTTCTGGTGGTCTGGGATGCCTTGTTTGCAGACGGCCTCAGCCTGGGTTTAGTAGATTATATCTTCGTAGCCATGTTACTTTACATCCGAGATGCTTTGATCTCTAGTAACTACCAGACCTGTCTCGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Jian Xie et al.
Cell reports, 31(10), 107750-107750 (2020-06-11)
During virus entry, human papillomaviruses are sorted by the cellular trafficking complex, called retromer, into the retrograde transport pathway to traffic from the endosome to downstream cellular compartments, but regulation of retromer activity during HPV entry is poorly understood. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service