Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

SAB4502150

Sigma-Aldrich

Anti-ATP6V1H antibody produced in rabbit

affinity isolated antibody

Synonyme(s) :

V-ATPase 50/57 kDa subunits, V-ATPase subunit H, VMA13, Vacuolar proton pump subunit H, Vacuolar proton pump subunit SFD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
12352203
Nomenclature NACRES :
NA.41

Le tarif et la disponibilité ne sont pas disponibles actuellement.

Source biologique

rabbit

Niveau de qualité

Conjugué

unconjugated

Forme d'anticorps

affinity isolated antibody

Type de produit anticorps

primary antibodies

Clone

polyclonal

Forme

buffered aqueous solution

Poids mol.

antigen 55 kDa

Espèces réactives

mouse, human

Concentration

~1 mg/mL

Catégories apparentées

Comparer avec des articles similaires

Voir la comparaison complète

Montrer les différences

1 of 4

Cet article
EHU142071EHU069311EHU001091
Ensembl | human accession no.

ENSG00000072110

Ensembl | human accession no.

ENSG00000204633

Ensembl | human accession no.

ENSG00000100813

Ensembl | human accession no.

ENSG00000077522

Gene Information

human ... ACTN1(87), ACTN1(87)

Gene Information

human ... ACTN3(89), ACTN3(89)

Gene Information

human ... ACIN1(22985), ACIN1(22985)

Gene Information

human ... ACTN2(88), ACTN2(88)

esiRNA cDNA target sequence

GGCAAGATGAGAGTGCACAAGATCTCCAACGTCAACAAGGCCCTGGATTTCATAGCCAGCAAAGGCGTCAAACTGGTGTCCATCGGAGCCGAAGAAATCGTGGATGGGAATGTGAAGATGACCCTGGGCATGATCTGGACCATCATCCTGCGCTTTGCCATCCAGGACATCTCCGTGGAAGAGACTTCAGCCAAGGAAGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTACAAAAATGTCAACATCCAGAACTTCCACATAAGCTGGAAGGATGGCCTCGGCTTCTGTGCTTTGATCCACCGACACCGGCCCGAGCTGATTGACTACGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAATACGGCTTTTGACGTGGCAGAGAAGTACCTGGACATCCCCAAGATGCTGGATGCCGAAGACATCGTTGGAACTGCCCGACCGGATGAGAAAGCCATCATGACTTACGTGTCTAGCTTCTACCACGCCTTCTCTGGAG

esiRNA cDNA target sequence

TCAAACTCATGCTGCTCCTGGAGGTCATTTCAGGTGAGAGGCTGCCTAGGCCAGATAAAGGCAAGATGCGCTTCCACAAAATCGCCAACGTTAACAAGGCCCTGGACTTCATTGCCAGCAAGGGGGTTAAACTGGTGTCCATTGGTGCTGAAGAGATTGTTGACGGGAACCTGAAGATGACCCTGGGCATGATCTGGACCATCATCCTTCGCTTCGCCATCCAGGACATCTCTGTGGAAGAAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGCTGGAAGGATGGCCTGGCCCTCTGTGCCCTCATCCACCGACACCGCCCTGACCTCATCGACTACGCCAAACTGCGAAAGGATGACCCCATCGGAAACCTGAACACT

esiRNA cDNA target sequence

TCCCCAGGTGTCAGTAGAGGTGGCCTTGCCCCCACCTGCAGAGCATGAAGTAAAGAAAGTGACTTTAGGAGATACCTTAACTCGACGTTCCATTAGCCAGCAGAAGTCCGGAGTTTCCATTACCATTGATGACCCAGTCCGAACTGCCCAGGTGCCCTCCCCACCCCGGGGCAAGATTAGCAACATTGTCCATATCTCCAATTTGGTCCGTCCTTTCACTTTAGGCCAGCTAAAGGAGTTGTTGGGGCGCACAGGAACCTTGGTGGAAGAGGCCTTCTGGATTGACAAGATCAAATCTCATTGCTTTGTAACGTACTCAACAGTAGAGGAAGCTGTTGCCACCCGCACAGCTCTGCACGGGGTCAAATGGCCCCAGTCCAATCCCAAATTCCTTTGTGCTGACTATGCCGAG

esiRNA cDNA target sequence

GATGGAGCACATTCGTGTTGGATGGGAGCTGCTGCTGACAACCATCGCCAGAACCATCAATGAGGTGGAGACTCAGATCCTGACGAGAGATGCGAAGGGCATCACCCAGGAGCAGATGAATGAGTTCAGAGCCTCCTTCAACCACTTTGACAGGAGGAAGAATGGCCTGATGGATCATGAGGATTTCAGAGCCTGCCTGATTTCCATGGGTTATGACCTGGGTGAAGCCGAATTTGCCCGCATTATGACCCTGGTAGATCCCAACGGGCAAGGCACCGTCACCTTCCAATCCTTCATCGACTTCATGACTAGAGAGACGGCTGACACCGACACTGCCGAGCAGGTCATCGCCTCCTTCCGGATCCTGGCTTCTGATAAGCCATACATCCTGGCGGAGGAGCTGCGTCGGGAGCTGCCCCCGGATCAGGCCCAGTACTGCATC

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_001102

NCBI accession no.

NM_001104

NCBI accession no.

NM_014977

NCBI accession no.

NM_001103

Description générale

The gene ATP6V1H (ATPase H+ transporting V1 subunit H) is mapped to human chromosome 8q11.2. It encodes a lysosomal protein with a molar mass of 50/57kDa. This protein forms the subunit of vacuolar ATPase (V-ATPase), a protein widely found in various eukaryotic endomembrane organelles. V-ATPase is a member of the rotary ATPase family, the members of which use rotary motor mechanisms for the transportation of ions across membranes. V-ATPase has two domains, V0 and V1 that function in transportation of proton and hydrolysis of ATP, respectively. The V1 domain is composed of eight subunits, A-H.

Immunogène

The antiserum was produced against synthesized peptide derived from human ATP6V1H.

Immunogen Range: 341-390

Actions biochimiques/physiologiques

The gene ATP6V1H (ATPase H+ transporting V1 subunit H) encodes the regulatory subunit H of the V1 domain of V-ATPase. This multisubunit complex of V-ATPase functions in the acidification of intracellular compartments via the energy generated from ATP hydrolysis. Therefore, V-ATPase participates in receptor-mediated endocytosis, intracellular trafficking processes and degradation of proteins. Down-regulation of ATP6V1H gene in human pancreatic islets has been associated with type 2 diabetes. Its expression is negatively associated with HbA1c levels. It has a positive regulatory effect on glucose-stimulated insulin secretion.

Caractéristiques et avantages

Evaluate our antibodies with complete peace of mind. If the antibody does not perform in your application, we will issue a full credit or replacement antibody. Learn more.

Forme physique

Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol.

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

nwg

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Besoin d'un modèle de COA ?

Ceci est un modèle de certificat d'analyse (COA pour Certificate of Analysis) et peut ne pas être représentatif d'un lot récemment fabriqué de ce produit spécifique.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Decreased expression of ATP6V1H in type 2 diabetes: a pilot report on the diabetes risk study in Mexican Americans.
Molina MF
Biochemical and Biophysical Research Communications, 412, 728-731 (2011)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique