HLTUD1251
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-3200-5p
Synonyme(s) :
Tough Decoy, TuD
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Gamme de produits
MISSION®
Forme
liquid
Concentration
≥1x106 VP/ml (via p24 assay)
Technique(s)
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
Séquence mature
AAUCUGAGAAGGCGCACAAGGU
Numéro d'accès Sanger mature/mineur
Numéro d'accès Sanger microARN
Conditions d'expédition
dry ice
Température de stockage
−70°C
Description générale
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Autres remarques
Based on miRBase V19 Mature ID
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Code de la classe de stockage
12 - Non Combustible Liquids
Classe de danger pour l'eau (WGK)
WGK 3
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Certificats d'analyse (COA)
Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique