Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU201271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGATTAGCCAAAAGACATCTGATGGCCAGGCAGTTCCATAAACATGCAAAGCCAGCCCCTGAATCACTAGTCGCCAGCCCTCCATGGCACACAACTGCTTTTCAAGTGTATTTGGCCTCTGCACTCGGGACTCTCTGTTCTTGGGTGGATGCTGCGCTGGTCCAGTATGGTACAAGCCTACATGATAGAGCTGGATTGATTTTTCTGCCAAGCCTGTGTGGGCATTTTATAAGCTACGTGTTCTAATTTTTACCGATGTTAATTATTTTGACAAATATTTCATATATTTTCATTGAAATGCGCAAATCCGCTTGCTCAGTTCCCTGAGCTAAGGGAATAACACTTGCCTTAAATTTCCCCAACCTCGTCTCTCTCCACATGGTCCTGCTCTCCTCTCTGACTGTAATGTGTTTGTCTTGTCACCTGTAGGTGGCAAGGACTCAGCTGTTGTCTGTTGAATCCACACTTCAAATAAGAAATCAGTGAAGCAAATCTAATGTTAACCCTGA

Numéro d'accès Ensembl | souris

ENSMUSG00000030513

Numéro d'accès NCBI

NM_011048

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... PCSK6(18553) , Pcsk6(18553)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique