Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU184491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gapdh

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAAGAAGGTGGTGAAGCAGGCATCTGAGGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACCAGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGTAAGAAACCCTGGACCACCCACCCCAGCAAGGACACTGAGCAAGAGAGGCCCTATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACCCCCATAATAACAGGAGGGGCCTAGGGAGCCCTCCCTACTCTCTTGAATACCATCAATAAAGTTCGCTGC

Numéro d'accès Ensembl | souris

ENSMUSG00000057666

Numéro d'accès NCBI

NM_008084

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GAPDH(100042025) , Gapdh(14433)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feifei Feng et al.
Environmental health perspectives, 120(12), 1692-1698 (2012-09-27)
The role of the Nlrp3 inflammasome in nonallergic airway hyperresponsiveness (AHR) has not previously been reported. Recent evidence supports both interleukin (IL) 1β and short fragments of hyaluronan (HA) as contributors to the biological response to inhaled ozone. Because extracellular
Laurence Booth et al.
Molecular cancer therapeutics, 13(10), 2384-2398 (2014-08-12)
The present studies examined the toxic interaction between the non-coxib celecoxib derivative OSU-03012 and phosphodiesterase 5 (PDE5) inhibitors, and also determined the roles of endoplasmic reticulum stress response regulators in cell survival. PDE5 inhibitors interacted in a greater than additive
Danielle Bartlett et al.
PloS one, 10(4), e0124154-e0124154 (2015-04-17)
Melanoma is a highly aggressive and drug resistant form of skin cancer. It arises from melanocytes, the pigment producing cells of the skin. The formation of these melanocytes is driven by the transcription factor PAX3 early during embryonic development. As
Shlomit Farkash-Amar et al.
PLoS genetics, 10(3), e1004176-e1004176 (2014-03-08)
To understand gene function, genetic analysis uses large perturbations such as gene deletion, knockdown or over-expression. Large perturbations have drawbacks: they move the cell far from its normal working point, and can thus be masked by off-target effects or compensation
Antonella Izzo et al.
Human molecular genetics, 23(16), 4406-4419 (2014-04-05)
Mitochondrial dysfunction, which is consistently observed in Down syndrome (DS) cells and tissues, might contribute to the severity of the DS phenotype. Our recent studies on DS fetal hearts and fibroblasts have suggested that one of the possible causes of
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique