Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU158101

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Abcb5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGCCAACAGGGATAAGCAGGCGCTCAAGCGTGCTGGAAAGATAGCAACAGAAGCTGTGGAGAACATACGTACGGTAGTGTCATTAACAAGAGAGAGAGCCTTTGAGCAAATGTATGAGGAGACACTTCAGACTCAACACAGGCCAGCACATCCTAACTTCTCATGTGACTTCACCAAGAGAAAATCAAGTGCTAACACAACCAAAAAGTATAGGTTCCCACGCAATCATCTGATCCTCAGTGAGGGCACAGAATCAACTTATTTCTGAAAGAAAGTTGAATGGAAGAGAGAAAATAGGATGGCTCACTCTTTTATGTTAGATCTCTAAGAGAGCTTAAATGTAAAGCAAATGTGTACTCTGCGCTTATTTAATGGCCCTTATCACCCTGCCTCTGTCTTTGTATTTATCAGAAAGATAGTTTTGTTCTCATTTCCACTGACGTCTGTAGTCTGCACCACCCACAGATTGCCACTACATATTCTATGAGTGTTAGGTCATGATGGAAAT

Numéro d'accès Ensembl | souris

ENSMUSG00000072791

Numéro d'accès NCBI

NM_029961

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... ABCB5(77706) , Abcb5(77706)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ge Yang et al.
Molecular medicine reports, 12(3), 3930-3936 (2015-06-06)
MicroRNAs (miRNAs) are small non-coding RNAs, which are important in the development of multidrug resistance in cancer by regulating gene expression at the post‑transcriptional level. The present study investigated the functional effects of miR‑522 in chemoresistant colon cancer cells. The
Naruji Kugimiya et al.
Journal of cellular and molecular medicine, 19(7), 1569-1581 (2015-02-18)
c-MYC overexpression is frequently observed in various cancers including colon cancer and regulates many biological activities such as aberrant cell proliferation, apoptosis, genomic instability, immortalization and drug resistance. However, the mechanism by which c-MYC confers drug resistance remains to be

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique