Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU068571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tpx2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le15 avril 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le15 avril 2025

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAGCGAATCAAGCAACATCCCAAGAACCAGGAAGAGTATAAGGAAGTGAACTTCATGTCTGAACTTCGGAAGCATTCTTCCACGCCTGCCCGAGGAACCAGAGGATGCACTATCATTAAGCCTTTCAACCTGTCCAAAGGGAAGAAAAGAACATTTGATGAAGCAGCTTCTACGTATGTGCCCATTGCACAGCAGGTTGAAGCCTTCCACAAACGAACCCCCAATAGATACCATCTGAGGAACAAGAAGGACGAGAGCTTGTTACCCTCCAAATCTGTGAACAAGATTGCACGAGACCCCCAGACCCCCATACTGCAGACCAAATATCGTACAAGGGCTGTGACTTGCAAAAGTACTGCAGAGCAGGAGGCCGAGGAGCTTGAGAAACTGCAACAATACAAATTCAAAGCACGGGAACTTG

Numéro d'accès Ensembl | souris

ENSMUSG00000027469

Numéro d'accès NCBI

NP_001135450

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... TPX2(72119) , Tpx2(72119)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
AOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study
Helen Chen et al.
Cell cycle (Georgetown, Tex.), 13(14), 2248-2261 (2014-05-31)
Construction of a mitotic spindle requires biochemical pathways to assemble spindle microtubules and structural proteins to organize these microtubules into a bipolar array. Through a complex with dynein, the receptor for hyaluronan-mediated motility (RHAMM) cross-links mitotic microtubules to provide structural

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique