Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU043451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tcfe2a

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGGAGGAGGAGAAGGTGTCTGGCGTGGTCGGGGACCCACAGCTGCCCCTGTCAGCCGCCCACCCGGGCCTGGGTGAGGCCCACAACCCAGCCGGGCACCTGTGAGCCGTCACAGCTTCTTCGTTGGACCAGGGACCACCATATCTCTGCCCGGGGTGCATCAGGACGGTTCTGGATGAGACAGGTCTCCATCGAAGCATGAGCAGAGAGAGGGCTCTGGGGACACTTCAGGGCCTGGGGAGGGTGGCACTGAACAGCTCCCTGCTTGGCCCCAGTGACCAAGCAGAAAAGTTCCTTCCTCTCGGTTAACCAGAACTGGAAACAAAGCAGCATGCTCCCTTTTCAAAAAGGAAAGAAAGATGCCTTAACTATGTAAGACGGAAGAGTCGGACCGTGCCCTGGCAGGGCGGCCTGGGACTGGCTTCTACTTCAGAGCCACCAGCACATCGTGCCTAAGCATTTTTCGTTTTTTTAAAGGAGAATAAAGGAACATTAGTTTTCAGATTTTTTTTTTAAATGTAGACAAAAGTTAGCAAGAACGAGGCCTTC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Indira Tiwari et al.
Cancer letters, 362(1), 131-138 (2015-03-31)
Downregulation of E-cadherin is a hallmark of epithelial-mesenchymal transition (EMT), an essential component of cancer progression to more aggressive phenotypes characterized by tumor dedifferentiation, infiltration, and metastasis. However, the underlying mechanism for E-cadherin downregulation in hepatitis C virus (HCV)-associated hepatocellular
Atsushi Kuwahara et al.
PloS one, 9(5), e94408-e94408 (2014-05-17)
During mouse neocortical development, the Wnt-β-catenin signaling pathway plays essential roles in various phenomena including neuronal differentiation and proliferation of neural precursor cells (NPCs). Production of the appropriate number of neurons without depletion of the NPC population requires precise regulation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique