Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU023971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Zeb1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGCAGCTGACTGTGAAGGTGGCATGCCAGATGATGAACTGCCAGCAGACCAGACAGTATTACCAGGAGGCAGTGACAGGGGGGGCGGTGCCAAGAACTGCTGGCAAGACAACGTGAAAGACAACGAGTGTGACTCAGATGCAGAAAATGAGCAAAACCATGATCCGAATGTGGAAGAATTTCTGCAGCAACAAGACACCGCCGTCATTTATCCTGAGGCGCCCGAGGAAGACCAGCGGCAGGGCACACCAGAAGCCAGCAGTCATGATGAAAACGGAACACCAGATGCATTTTCCCAGTTGCTCACCTGCCCGTATTGTGATAGAGGCTACAAGCGCTTTACCTCTTTGAAAGAACACATTAAGTACCGCCATGAGAAGAACGAGGACAACTTCAGCTGCTCCCTGTGCAGTTACACCTTTGCATACAGAACCCAGCTTGAACGTCAT

Numéro d'accès Ensembl | souris

ENSMUSG00000024238

Numéro d'accès NCBI

NM_011546

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... ZEB1(21417) , Zeb1(21417)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jaehyuk Choi et al.
Nature genetics, 47(9), 1011-1019 (2015-07-21)
Cutaneous T cell lymphoma (CTCL) is a non-Hodgkin lymphoma of skin-homing T lymphocytes. We performed exome and whole-genome DNA sequencing and RNA sequencing on purified CTCL and matched normal cells. The results implicate mutations in 17 genes in CTCL pathogenesis
Minfei Jin et al.
PloS one, 9(8), e103965-e103965 (2014-08-05)
MicroRNA (miR)-150 has been reported to be dramatically downregulated in human epithelial ovarian cancer (EOC) tissues and patients' serum compared to normal controls. This study aimed to investigate clinical significance and molecular mechanisms of miR-150 in EOC. In the current
Zhenduo Lu et al.
Molecular cancer, 14, 102-102 (2015-05-15)
Restin belongs to MAGE superfamily and is known as MAGE H1. Restin was firstly cloned from HL-60 cells treated with all-trans retinoic acid (ATRA). Previous studies showed a pro-apoptotic role of Restin in several cell lines. However, little information is
Ashley M Holder et al.
Oncotarget, 6(23), 19500-19513 (2015-05-07)
Rapamycin analogues have antitumor efficacy in several tumor types, however few patients demonstrate tumor regression. Thus, there is a pressing need for markers of intrinsic response/resistance and rational combination therapies. We hypothesized that epithelial-to-mesenchymal transition (EMT) confers rapamycin resistance. We

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique