Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU015001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGTCACTAGGGGCTTCAGAAGAGCGCCTCTCTCCAGCCCTTGGCATCACCTGGGCTAACCAGCTCCTGATGCGACTGATGGTTGACCGCACCCATGAGGACGATGTTACCACAGGCTTGCCCAGAAGCCCAGTTCGGACTCTCCGAGTGCTCTTCGCCCCCCACCTACCCCTCTCCTCCTGCTGCTACACAGTCAGTGGGGAAGGCATTAGGGGGATGCCAGGAACACAGTCCTACTAACAGTGAGACCAGTGGGTCAGCCTGAGCAGGTCCCAAGGAACCCTGATTCTGATGACTCTTTCCAACAACCTGTCAGTCAGTGGCACCTGGTGAACAGGCACCCAGTGACGGTTAGTCTGTCAGTATCTGCTCTCTCCTCCCTGGGGTTCACCTACCCATTAGAGGATGACTGAGCAGCAGGAGCTCT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique