Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU011161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gpnmb

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGCCAGCATCTCAGGTTCCCGGACAGGAGGCCCTTCCCTCGCCCCCATGGATGGAAGAAATGGAGCTTTGTCTACGTCTTTCACACACTTGGCCAGTATTTCCAAAAACTGGGTCGGTGTTCAGCACGGGTTTCTATAAACACAGTCAACTTGACAGCTGGCCCTCAGGTCATGGAAGTGACTGTCTTTCGAAGATACGGCCGGGCATACATTCCCATCTCGAAGGTGAAAGATGTGTATGTGATAACAGATCAGATCCCTGTATTCGTGACCATGTCCCAGAAGAATGACAGGAACTTGTCTGATGAGATCTTCCTCAGAGACCTCCCCATCGTCTTCGATGTCCTCATTCATGATCCCAGCCACTTCCTCAACGACTCTGCCATTTCCTACAAGTGGAACTTTGGGGACAACACTGG

Numéro d'accès Ensembl | souris

ENSMUSG00000029816

Numéro d'accès NCBI

NM_053110

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GPNMB(93695) , Gpnmb(93695)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Yu-Liang Wang et al.
International journal of clinical and experimental pathology, 8(6), 6498-6504 (2015-08-12)
Glycoprotein (transmembrane) nonmetastatic melanoma protein b (GPNMB) plays crucial roles in odontogenesis. However, the role of GPNMB in human dental pulp cells (hDPCs) is still unclear. Therefore, in this study, we investigated the expression and function of the GPNMB in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique