Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU003641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp6ap2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCTTTCTCTCCGAACTGCAAGTGCTACATGATATTTCCAGTTTGTTGTCTCGTCATAAGCATCTAGCCAAGGACCATTCACCCGACTTGTATTCATTGGAGCTGGCAGGTTTGGATGAACTTGGGAAGCGTTATGGGGAAGACTCTGAACAGTTCAGGGATGCTTCTAAGATCCTTGTTGATGCTCTCCAAAAGTTTGCAGATGACATGTACAGTCTCTATGGTGGGAACGCAGTGGTAGAGTTAGTGACTGTCAAATCATTCGACACATCCCTTGTGAGGAAGTCAAGGACCATCCTTGAGGCAAAACAAGAGAACACCCAAAGTCCTTATAACCTTGCATATAAGTATAATTTGGAGTATTCAGTGGTTTTCAACTTGGTACTGTGGATTATGATCGGCTTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wendy W Batenburg et al.
PloS one, 9(6), e100954-e100954 (2014-06-27)
Dysfunction of renin-angiotensin system (RAS) contributes to the pathogenesis of diabetic retinopathy (DR). Prorenin, the precursor of renin is highly elevated in ocular fluid of diabetic patients with proliferative retinopathy. Prorenin may exert local effects in the eye by binding
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique